9/10/09 1) What 3 things should be written at the start of class without being told?
2) How much talking is allowed at the start of class?
9/11/09 1) What needs to be done before the tardy bell rings?
2) List the 5 sections that need to be in your 3-ring folder.
9/14/09 1) Think of some experiments you've done in past years. List some steps that are common to every experiment.
9/15/09 1) What is a hypothesis?
2) Does it matter if your hypothesis turns out to be incorrect? Explain.
9/16/09 1) What are some resources you can use to "gather information" before doing an experiment?
2) When should you write a conclusion?
9/17/09 1) Describe some ways that you can record the result of an experiment.
9/18/09 1) Use dimensional analysis to find the number of years in 6832800 minutes.
9/21/09 1) Convert by moving the decimal point:
a) 321.4 dm = _____mm
b) 43.75 cm = ____hm
2) Why can't you just move the decimal point with time conversions?
9/22/09 1) Convert
a) 750 mm = ______ km
b) .0048 dkm = _______ cm
c) 100.4 dg = _______ g
9/23/09 1) What units (mm, cm, m, or km)would be best to measure the following?
a) length of your finger
b) thickness of a penny
c) distance to downtown los angeles
d) distance across the classroom
9/24/09 1) What units (mL, L, or kL) would be best to measure the following?
a) water in a pool
b) soda can
c) bucket of water
9/25/09 1) In this class, we will measure things using the ________ system.
2) When using a ruler, we will never measure with the ________ side.
9/29/09 1) List 3 possible explanations why Diet Coke floats in water while regular Coke sinks.
9/30/09 1) If all the following were placed in a graduated cylinder, draw what would happen:
Object Density
water 1.0
plastic 1.16
wood 0.7
bead .95
oil .925
glycerin 1.26
marble 2.4
10/1/09 1) Density = ?
2) Units for solids will be g/cm3, but liquids should be ________.
10/2/09 1) If 2 objects are the same size, the one with the greater _________ will be denser.
2) Why does oil float above water?
10/5/09 1) Steel has a greater density than water, yet a steel boat floats. Explain.
10/6/09 1) Draw the forces on a boat.
2) Which force must be larger? (boat is floating)
10/7/09 1) The buoyant force is equal to the weight of the fluid ___________.
2) If the buoyant force is greater than the weight, an object will ____________.
10/8/09 1) Describe how a fish and submarine can change their densities.
10/9/09 1) ________ and _________ will determine whether an object will float or sink.
10/12/09 1) Explain why a person can lay on a "bed of nails" without getting injured.
10/13/09 1) Why can't a scuba diver survive hundreds of feet underwater?
2) If a force is exerted on a small area, the pressure will be ___________.
10/14/09 1) What would happen to an unopened bag of chips taken to the top of Mount Everest? Explain.
2) Find Pressure if F=63 N and A=3 m^2
10/15/09 1) At the bottom of a mountain, there is higher air pressure because ________________.
2) Find Pressure if F=48 N and A=8 m^2
10/19/09 1) Las Vegas is 280 miles away. How fast must one drive to get there in 4 hours?
2) Label the coordinates of each point:
<<picture of a graph with points at (0,0), (2,20), and (4,40)
10/20/09 1) The slope of a distance vs. time graph is _________.
2) Find the slope of the graph:
<<picture of a graph with points at (0,0), (2,40), (4,80), and (6,120)
10/21/09 1) A runner travels at 3 km/h for 360 minutes. How far did he/she run?
10/22/09 1) A bus's maximum speed is 120 km/h. Is it possible for the bus to travel 730 km in 6 hours? Explain.
10/23/09 1) Johnny walks at a speed of 2.5 m/s. If his next class is 800 m away, will he make it there on time?
10/26/09 1) A car accelerates when getting on and off the freeway. Define acceleration.
2) Find the average speed.
<<picture of a graph with points at (0,0), (2,100), and (4,200)
10/27/09 1) Give an example of each of the 3 types of acceleration.
10/28/09 1) A car travels north at 60 miles/hr for 10 minutes. Is the car accelerating? Explain.
10/29/09 1) initial velocity = 10 m/s
final velocity = 50 m/s
time = 4 s
acceleration = ?
10/30/09 1) A cat runs at 6 m/s until it is stopped by a car. This takes 3s. Find the acceleration of the cat.
11/2/09 1) You are in a car going 60 miles per hour. You throw a ball in the air in front of you. Does it hit you in the face? Explain.
11/3/09 1) Net force? Balanced or unbalanced?
a) 8 N right, 17 N left
b) 13 N right, 6 N left, 7 N left
c) 16 N right, 9 N right, 4 N left, 7 N left
11/4/09 1) Newton's 2nd Law states that Force = ______ x _______
2) When forces are ___________, you will have a change in velocity.
11/5/09 1) A 15 kg dog accelerates 5 m/s^2. What is it's force?
11/6/09 1) Describe the difference between kinetic and static friction.
2) Give 2 examples of kinetic friction.
11/9/09 1) Label all forces in the diagram.
<<picture of a boat moving to the right>>
11/10/09 1) Label all forces in the diagram.
<<picture of a car going up a hill>>
11/12/09 1) Label all forces in the diagram.
<<picture of a shoe being pulled with a spring scale>>
11/13/09 1) Label all forces in the diagram.
<<picture of a hangman>>
11/16/09 1) Describe the difference between the applied force and friction force.
11/17/09 1) Momemtum = _______ x ________
2) Find the momemtum of a 140 kg boy running 3 m/s
11/18/09 1) An object that is not moving always has a momentum of _________.
2) The Law of __________ says that the total momentum before and after a collision is _________.
11/19/09 1) Find the velocity of the cat after the inelastic collision:
<<picture of a cat chasing a bird and later catching the bird>>
cat has a mass of 14 kg and velocity of 6 m/s
bird has a mass of 2 kg and velocity of 5 m/s
11/20/09 1) Describe the difference between elastic and inelastic collisions.
2) Give 2 examples of each.
11/30/09 1) List 3 things that have energy and why you believe so.
12/1/09 1) Make a t-chart to identify differences between kinetic and potential energy.
12/2/09 1) An object that is not moving will always have a KE of _______.
2) Find the gravitational PE of a 18 kg ball 30 m above the ground.
12/3/09 1) Energy from food/drink that is unused gets stored in the body as ______.
2) What type of energy is in food/drink?
12/4/09 1) Chemical potential _________ from the nut is transferred to the _____________ which we measure using a ___________________.
12/7/09 1) The law of _________ of energy states that energy cannot be created or _____________. It can only be ________ from one form
to another.
12/8/09 1) List 3 things that you know about global warming.
12/9/09 1) Explain how global warming could result is some species going extinct.
12/10/09 1) List 4 things that can be done to help solve the global warming problem.
12/14/09 1) Label the diagram showing where there would be PE, KE, and both.
<<picture of a roller coaster with 4 parts of the track to label>>
12/15/09 1) Describe the features of a good roller coaster. (use the terms PE, KE, rolling friction, air resistance)
12/16/09 1) Explain how you can find the PE at the start of a roller coaster
2) Explain how you can find the KE at the end of a roller coaster.
12/18/09 1) Do you expect the roller coaster to have more energy at the start or at the end? Explain.
1/11/10 1) List some similarities and differences between a cup of water, an ice cube, and steam.
1/12/10 1) Give 3 examples of each of the states of matter.
1/13/10 1) Draw the change of state graph, labeling all stages.
1/14/10 1) Draw the arrangement of particles in a solid, liquid, & gas.
1/15/10 1) Complete the change of state graph for dry ice.
1/19/10 1) What happens to the temperature while a substance undergoes a change of state?
1/20/10 1) 0 C is the melting point of water. 0 C is also called the _______ point.
1/21/10 1) Explain why salt should make the boiling point of water increase.
1/22/10 1) A pure substance that cannot be separated into simpler substances is called an ____________.
2) Some examples include oxygen, _________, __________, & __________.
1/25/10 1) Compound or mixture?
a) water
b) sandwich
c) deck of playing cards
d) table salt
1/26/10 1) Chlorine is dissolved in a swimming pool. What is the solute? Solvent?
1/27/10 1) Last year, you learned that all living things are made of ________.
2) All things, living or non, are made of ___________.
1/28/10 1) How many protons, neutrons, and electrons does iron (Fe) have?
1/29/10 1) The ______ table lists all the known ________ in the universe.
2) Particles that orbit the nucleus are the negatively charged __________.
2/1/10 1) Find the number of protons , neutrons, and electrons for calcium (Ca).
2/2/10 1) Find the number of protons, neutrons, and electrons for gold (Au).
2/3/10 1) Look at the diagram of the electron orbital diagram. What element does it represent?
<<diagram of an electron orbital diagram for Ar>>
2/4/10 1) Look at the diagram of the electron orbital diagram. What element does it represent?
<<diagram of an electron orbital diagram for O>>
2/5/10 1) Which element?
a) metalloid in period 3
b) period 2 with 6 valence electrons
c) 4 protons and 5 neutrons
2/9/10 1) What is a procedure and why is it important?
2/10/10 1) Draw a Lewis Dot structure for Be and Mg (both from group 2). What can you conclude about the relationship between valence
electrons and group #?
2/11/10 1) Draw a Lewis Dot structure. What do these atoms want?
a) S b) F c) Li d)Ca
2/12/10 1) Show how Mg and O will form an ionic bond.
2/16/10 1) Ions can be ____________ or ___________ charged. Oppositely charged ions can form an __________ bond.
2/17/10 1) Draw the Lewis Dot structures for Carbon and Oxygen.
2) Could carbon monoxide (CO) be formed by an ionic bond? Explain.
2/18/10 1) Draw the Lewis Dot structure for carbon dioxide.
2) Make the model for carbon dioxide.
2/19/10 1) Draw the Lewis Dot structure for water.
2) Make the model for water.
2/22/10 1) A 2H2 + O2 ----> 2H2O
B raisins + m&m's + nuts ----> trail mix
A is a chemical reaction, but B is not. explain why
2/23/10 1) Give 2 examples of a physical change and 2 examples of a chemical change
2/24/10 1) Endothermic or exothermic reaction?
a) burning candle
b) glow stick
c) cold pack
d) photosynthesis
e) fireworks exploding
2/25/10 1) List the 5 indicators of a chemical reaction.
2) Do they always indicate a chemical reaction?
2/26/10 1) What happens to bonds when a chemical reaction occurs?
3/1/10 1) First the penny will be coated with zinc to make it look ________. Then it will be _______ to make the copper and zinc bond to form _________.
3/2/10 1) How many oxygen atoms?
a) H2O
b) 3H2O
c) CO2
d) Zn(NO3)2
3/3/10 1) Substances you start with are called __________ and substances that are made are called _________.
2) How many hydrogen atoms?
a) 3NaOH
b) 2C2H5OH
3/4/10 1) Why must a chemical equation always be balanced?
2) Balance the equation: H2 + O2 ---> H2O
3/5/10 1) Balance the equation: Fe + Cl2 ---> FeCl3
3/8/10 1) Balance the equations: H2SO4 + NaOH --> H2O + Na2SO4
H2O + CO2 --. H2CO3
3/9/10 1) Complete the chart:
Red Litmus Paper Blue Litmus Paper
Acid
Base
Neutral
3/10/10 1) Make an acid/base t-chart with at least 5 features of each
3/11/10 1) Make a Venn diagram that describes some similaritites and differences between acids and bases
3/12/10 1) Explain how the pH scale is organized (Label A-E)
0--------------6-7-8-------------14
A B C D E
3/15/10 1) Acids taste sour and bases taste bitter. WHy would that be a dumb way to test unknown substances?
2) What part of the pH scale is best suited for living things?
3/16/10 1) Orange juice has a pH = 5 while Coke's pH = 3. Would your tongue be a good indicator to identify this difference? Explain.
3/17/10 1) How could you used pH paper and lithmus paper to test a solid like salt or bread?
3/22/10 1) The "lead" in a pencil and a diamond are both made of carbon. How could this be possible?
3/23/10 1) The body's main source of energy is from __________. Reserve energy is stored as ____________.
2) When iodine touches starch, it turns _________ color.
3/24/10 1) Based on yesterday's activity, which food groups contained carbohydrates?
3/25/10 1) The element ________ forms the backbones of many molecules important for living things. These molecules include carbohydrates, ___________,
_______________, and __________________.
3/26/10 1) In yesterday's experiment, _______ reacts first with vitamin C. When all the vitamin C runs out, the iodine then reacts with ___________
and turns a __________ color.
4/5/10 1) A monomer is a single unit while a polymer is a _______________________.
2) Name 3 examples of polymers.
4/6/10 1) Where is genetic information stored in the body?
4/7/10 1) Transcribe and translate:
DNA: TAC GAT TAG CAT ACT
4/8/10 1) Transcribe and translate:
DNA: CCGTATTACGTCGAGACTTGTAG
4/9/10 1) DNA is transcribed to RNA in the _______ of cells. The RNA is transported to the __________ where it is translated into _________.
4/14/10 1) How can astronomers gather information about other planets and stars?
4/15/10 1) Astronomers can study emissions and _______ lines to find the ________ of a star.
4/16/10 1) Describe 2 reasons that one star may appear brighter than another star in the night sky.
4/26/10 1) Describe the difference in color between cool, average, and hot stars.
4/28/10 1) Describe how temperature and luminosity are related.
2) Astronomers measures distances to stars in ________ years.
4/29/10 1) List the stages in the life cycle or our sun. What stage is it in now?
4/30/10 1) Large stars do not become white dwarfs at the end of their lives. What are the 3 possible outcomes?
5/3/10 1) What is the name of our galaxy?
2) List some objects that are in a galaxy.
5/4/10 1) Briefly describe the 3 types of galaxies. Which type is ours?
5/5/10 1) 2 Galaxies that are closer will move apart at a speed that is _______ than 2 galaxies that are further apart.
2) Ever since the universe was created in the ________ ________, it has been expanding.
5/6/10 1) List 5 types of satellites.
2) Why do rockets have stages when they are launched into space?
5/7/10 1) Explain how Newton's 3rd Law applies to a rocket taking off.
5/10/10 1) The moon doesn't produce its own light. Why does it appear to shine at night?
5/11/10 & 5/12/10 1) A lunar eclipse occurs when ____________'s shadow is on the ____________.
5/13/10 & 5/14/10 1) A solar eclipse occurs when the ________ goes between the ________ and the earth.
5/20/10 1) Man has not visited the moon since 1972 on Apollo 17. Why don't you think we have returned?
5/21/10 1) Where do you think man will travel next? Why?
5/24/10 1) Apollo's command module enters earth's atmosphere at over 24000 miles/hr. Would they have a chance to survive without parachutes?
Explain.
|
|