WEEK 1:
8/21 1) What 3 things should be written at the start of class without being told?
2) How much talking is allowed at the start of class?
8/22 1) What needs to be done before the tardy bell rings?
2) List the 5 sections that need to be in your 3-ring folder.
8/23 1) Think of some experiments you've done in past years. List some steps that are common to every experiment.
WEEK 2:
8/26 1) What is a hypothesis?
2) Does it matter if your hypothesis turns out to be incorrect? Explain.
8/27 1) What are some resources you can use to "gather information" before doing an experiment?
2) When should you write a conclusion?
8/28 1) Describe some ways that you can record the result of an experiment.
8/29 1) Use dimensional analysis to find the number of years in 6832800 minutes.
WEEK 3:
9/3 1) Convert by moving the decimal point:
a) 321.4 dm = _____mm
b) 43.75 cm = ____hm
2) Why can't you just move the decimal point with time conversions?
9/4 1) What units (mm, cm, or m)would be best to measure the following?
a) length of your finger
b) thickness of a penny
c) distance across the classroom
2) Describe a distance that you would measure in km.
9/5 1) What units (mL, L, or kL) would be best to measure the following?
a) water in a pool
b) soda can
c) bucket of water
9/6 1) In this class, we will measure things using the ________ system.
2) When using a ruler, we will never measure with the ________ side.
WEEK 4:
9/9 1) Describe the location of the
a) cat
b) man
<<picture of a grid with a man, cat, boat, flag, and car>>
9/10 1) List 3 things in the classroom that are moving.
2) Is the classroom moving? Explain.
9/11 1) Las Vegas is 280 miles away. How fast must one drive to get there in 4 hours?
2) Find the slope of the graph:
<<picture of a graph with points at (0,0), (2,40), (4,80), and (6,120)
9/12 1) A runner travels at 8 km/h for 180 minutes. How far did he/she run?
9/13 1) A bus's maximum speed is 120 km/h. Is it possible for the bus to travel 730 km in 6 hours? Explain.
Week 5:
9/16 1) Find the average speed.
<<picture of a graph with points at (0,0), (2,100), and (4,200)
9/17 1) A car accelerates when getting on and off the freeway. What could acceleration mean?
9/18 1) A car travels north at 60 miles/hr for 10 minutes. Is the car accelerating? Explain.
9/19 1) What are some things that affect the way a rocket flies?
9/20 1) Explain why it's not necessary to test a launch angle of 0 degrees and 90 degrees.
Week 6:
9/23 1) If we wanted to figure out the speed of the rocket, what could we do?
9/24 1) Do you think it matters which group member stomps on the bottle? Explain.
9/25 1) "The lighter the rocket, the better." Agree or disagree? Why?
9/26 1) A rocket is launched at 10 km/s. How far would it travel in 1 minute?
9/27 1) A rocket at rest is launch to 1400 m/s in 120 seconds. What is its acceleration?
Week 7:
10/1 1) You are in a car going 60 miles per hour. You throw a ball in the air in front of you. Does it hit you in the face? Explain.
10/2 1) 2 people are pushing a block towards the right with a force of 20 N each. What is the net force? Balanced or unbalanced?
10/3 1) The force of ___________ pulls a submarine down while the force of ___________ pushes it up. If the submarine is not
moving up or down, the forces are ______________.
10/4 1) A soccer ball is kicked onto the grass. Eventually it stops rolling. Why?
Week 8:
10/7 1) A soccer ball is rolled with the same force on notebook paper, napkins, and sandpaper. On which surface will the ball
roll the furthest? Explain.
10/8 1) Identify the 2 forces in the diagram. <<pic of skydiver>>
10/10 1) The car on the hill is not moving. Why?
Week 9:
10/14 1) Give an example of when friction is helpful and when it is harmful.
10/15 1) Label all forces in the diagram.
<<picture of a boat moving to the right>>
10/16 1) Label all forces in the diagram.
<<picture of a car going up a hill>>
10/17 1) Label all forces in the diagram.
<<picture of a hangman>>
10/18 1) Label all forces in the diagram.
<<picture of person sitting at a desk>>
Week 10
10/21 1) Netwon's _______ law states that for every ____________, there is an equal and opposite reaction.
10/22 1) Explain why you will need friction between the wheels of your mouse trap race car and the floor.
10/23 1) After testing your mouse trap race car, you will make modifications to try and make it faster.
What are some things that you might change?
10/24 1) When you set a mouse trap, what type of force is contained in the spring?
2) When the car is rolling, what 2 types of friction slow it down?
Week 11
10/28 1) Suppose that your mouse trap car's wheels spin out when you release the mouse trap. What type of
friction do you need more of?
2) What could you do to increase the friction between the wheels and floor?
10/29 1) Label all forces in the diagram.
<<picture of a swimmer>>
10/30 1) Label all forces in the diagram.
<<picture of a slingshot>>
10/31 1) Label all forces in the diagram.
<<picture of a trick or treater>>
11/1 1) Peanuts have _______ energy. When the peanut is burned, the energy is released into the __________,
which we measure using the _______________.
Week 12
11/4 1) Chemical ____________ energy is found in food like peanuts. Energy from food and drink that isn't used is
stored in the body as _________.
2) A peanut on a table has no kinetic energy. How could you give it some?
11/5 1) When a small piece of an asteroid (meteoroid) comes towards Earth, it burns up in the Earth's atmosphere
before hitting the ground. Why does this happen?
11/6 1) Scientists can study the _________ record to learn about extinction events in Earth's history.
2) What are some things that might affect the amount of damage an asteroid does?
11/7 1) What can change the motion of an object traveling through space?
11/8 1) Place the following parts of an example news segment in a logical order:
"Hello. John Smith and Leah Leslie here reporting breaking news for channel 4. An asteroid, named Etiam,
is apparently on a collision course with Earth."
"The asteroid will put millions in jeopardy as the destruction of an impact will be catastrophic. Notice in these video
simulations the serious destruction that is predicted." [video clips and pictures shown of simulated destruction]
"The government has coordinated a world-wide effort to attempt to save Earth from Etiam. The plan involves
......................................................." [video clips and pictures shown of the plan]
"So that's the deal. Hopefully disaster will be averted. From John Smith and Leah Leslie for channel 4 news,
stay safe and hope for best."
Week 13
11/12 1) List 3 things that you know or have heard about global warming.
11/13 1) Explain how global warming could result in some species going extinct.
11/14 1) List 4 things that can be done to help solve the global warming problem.
11/15 1) ________ __________ gas builds up in the atmosphere and causes __________ warming. It is produced when ________ fuels
are burned.
Week 14
11/18 1) Gravitational potential energy, kinetic energy, both, or none?
a) a pencil on the ground
b) a thrown baseball
c) a rock on the edge of a cliff
d) a bowling ball rolling
11/19 1) Label the diagram showing where there would be PE, KE, and both.
<<picture of a roller coaster with 4 parts of the track to label>>
2) Describe the features of a good roller coaster. (use the terms PE, KE, rolling friction, air resistance)
11/20 1) How will you be able to make sure that the marble has enough energy to make it to the end of your roller coaster?
11/21 1) Explain how you can find the PE at the start of a roller coaster.
Week 15
12/2 1) To find the KE at the end of your roller coaster, you need the mass and speed of the marble. How will you
find the speed?
12/3 1) Your roller coaster marble had less energy at the end than it did at the start. Where did the energy go?
12/4 1) gPE, KE, both, or none?
a) skateboarder riding
b) skateboarder doing kickflip
c) skateboarder resting
d) skateboarder getting ready to drop in
12/5 1) gPE, KE, both, or none?
a) roller coaster stopped on top of a hill
b) @ bottom of hill
c) going through loop
d) stopped at end
12/6 1) gPE, KE, both, or none?
a) water balloon held in the air
b) rolling bowling ball
c) sky diver falling
d) book on floor
Week 15
12/9 1) A strong earthquake in Los Angeles can be felt 120 miles away in San Diego. How is that possible?
12/10 1) _________ waves, such as an ocean wave, need a medium to transfer energy. _________ waves, such
as ____________, do not need a medium.
12/11 1) A higher frequency wave will have ____________ energy than a lower frequency wave.
2) A high frequency sound wave will have a ________ pitch, while a low frequency one will have a ________ pitch.
12/12 1) In today's activity, you and your group will make a wave machine. You will be able to make (transverse
or compression?) waves, which go up and down or side to side. Since the waves go through a medium, they are
waves (mechanical or electromagnetic?).
12/13 1) A wave transports its ______ without transporting ________.
Week 16
12/16 1) A low frequency leads to a low pitch and a high frequency a high pitch. Describe different ways that a person
can change the frequency of a guitar string?
12/17 1) Describe the different ways you were able to change the pitch using the glassware in yesterday's experiment.
Week 18
1/13 1) List some similarities and differences between a cup of water, an ice cube, and steam.
1/14 1) Give 2 examples of each of the states of matter.
1/15 1) Describe similarities and differences between Oxygen (O2) and Water (H2O).
1/16 1) Element or compound?
a) H
b) H2O
c) Na
d) NO
e) NaCl
1/17 1) Compound or mixture?
a) water
b) sandwich
c) deck of playing cards
d) table salt
e) pizza
Week 19
1/21 1) Last year, you learned that all living things are made of ________.
2) All things, living or non, are made of ___________.
1/22 1) How many protons, neutrons, and electrons does iron (Fe) have?
1/23 1) Based on the Lewis Dot Structures below, what must be true? (use the periodic table)
<<picture of Lewis Dot for Be, Mg, and Ca AND N, P, and As>>
1/24 1) What's similar about the 3 elements?
<<matching questions in same group, same period, metalloids, noble gases, and nonmetals>>
Week 20
1/27 1) Look at the Lewis Dot structures for Carbon and Oxygen. Could carbon monoxide (CO) be formed by an ionic bond? Explain.
1/28 1) Have you ever done a Science Fair experiment? If so, what did you do?
1/29 1) A 2H2 + O2 ----> 2H2O
B raisins + m&m's + nuts ----> trail mix
A is a chemical reaction, but B is not. explain why
1/30 1) Give 2 examples of physical changes and 2 examples of chemical changes.
1/31 1) Endothermic or exothermic reaction?
a) burning candle
b) glow stick
c) cold pack
d) photosynthesis
e) fireworks exploding
Week 21
2/3 1) Suppose you were doing a Science Fair experiment on cockroaches. What type of background information might you research?
2/4 1) What is a procedure? Why is it important?
2/5 1) Give 2 examples of physical changes and 2 examples of chemical changes.
2/6 1) First the penny will be coated with zinc to make it look ________. Then it will be _______ to make the copper and zinc bond to form _________.
2/7 1) Substances you start with are called __________ and substances that are made are called _________.
Week 22
2/8 1) How many oxygen atoms?
a) H2O
b) 3H2O
c) CO2
d) 4CO2
2/9 1) How many oxygen atoms?
a) CO
b) 2CO
c) 2C6H12O6
d) Zn(NO3)2
2/10 1) Balance the equation: C + H2 --> CH4
2/11 1) Chemical equations must be balanced because of the law of conservation of _____ . The total number of each atom in the reactants must be
___________ the total number of each atom in the products.
2/12 1) Describe what you think of when you hear the word "acid".
Week 23
2/18 1) Complete the chart:
Red Litmus Paper Blue Litmus Paper
Acid
Base
Neutral
2/19 1) Acids taste sour and bases taste bitter. Why would that be a dumb way to test unknown substances?
2) What part of the pH scale is best suited for living things?
2/20 1) Make a Venn diagram that describes some similaritites and differences between acids and bases
2/21 1) pH 0 = ? 6 = ? 7 = ? 8 = ? 14 = ?
Week 23
2/24 1)Orange juice has a pH = 5 while Coke's pH = 3. Would your tongue be a good indicator to identify this difference? Explain.
2/25 1) Carbon forms the backbone of many molecules needed by living things. What might make carbon such a good molecule for
this job compared to other elements like N, Ca, or F? (hint: look at periodic table)
2/26 1) The body's main source of energy is from __________. Reserve energy is stored as ____________.
2) When iodine touches starch, it turns _________ color.
2/27 1) The element ________ forms the backbones of many molecules important for living things. These molecules include carbohydrates, ___________,
_______________, and __________________.
2/28 1) In yesterday's experiment, _______ reacts first with vitamin C. When all the vitamin C runs out, the iodine then reacts with ___________
and turns a __________ color.
Week 24
3/2 1) To make the bouncing ball we used _ which is a polymer. _ caused the long chains to stick to each other.
3/3 1) Sometimes a criminal is caught because he left blood, skin, or hair at a crime scene. Explain.
3/4 1) What is DNA and why is it important?
3/5 1) Transcribe and translate:
DNA: TAC GAT TAG CAT ACT
3/6 1) 1) Transcribe and translate:
DNA: CCGTATTACGTCGAGACTTGTAG
Week 25
3/9 1) DNA is transcribed to RNA in the _______ of cells. The RNA is transported to the __________ where it is translated into _________.
3/12 1) In the Gattaca movie, Jerome was "genetically engineered". What does that mean?
3/13 1) Suppose that cancer ran in your family. Would you have a genetically engineered child if you could guarantee they wouldn't
get cancer? Explain.
|